 UBBFriend: Email This Page to Someone! |
 HUM-MOLGEN
 Open Topic Forum
 Primers
|
| next newest topic | next oldest topic |
| Author | Topic: Primers |
|
Rafid Member |
posted 05-09-2011 05:22 AM
   
Dear all Hum-Molgen forum members, Currently I am doing PCR for certain gene polymorphisms. CYP3A4*5 (653C>G)is one of the gene polymorphisms that I am targeting, I managed to design primers for this polymorphism (attached down with the message) with a PCR product size of 366bp. Blasting the primers in pubmed resulted in many products, among which the one that I am targeting. Please can I get your kind help and opinion to confirm the specificity and reliability that these primers will give the wanted product. Forward: GAGCAGTAGCTTAAGTGTTGGATG Reverse: CTACCCACAGTGGGGAGTGACT Thanking you in advance. IP: 119.40.120.198 |
All times are ET (US) | next newest topic | next oldest topic |
  |
|
Contact Us | HUM-MOLGEN
Copyright by HUM-MOLGEN 1995-2017
Powered by: Ultimate Bulletin Board, Version 5.44a
© Infopop Corporation (formerly Madrona Park, Inc.), 1998 - 2000.