home genetic news bioinformatics biotechnology literature journals ethics positions events sitemap


UBBFriend: Email This Page to Someone!
  HUM-MOLGEN
  Open Topic Forum
  Primers

Post New Topic  Post A Reply
profile | register | preferences | faq | search

next newest topic | next oldest topic
Author Topic:   Primers
Rafid
Member
posted 05-09-2011 05:22 AM     Click Here to See the Profile for Rafid   Click Here to Email Rafid     Edit/Delete Message Reply w/Quote
Dear all Hum-Molgen forum members,
Currently I am doing PCR for certain gene polymorphisms. CYP3A4*5 (653C>G)is one of the gene polymorphisms that I am targeting, I managed to design primers for this polymorphism (attached down with the message) with a PCR product size of 366bp. Blasting the primers in pubmed resulted in many products, among which the one that I am targeting.
Please can I get your kind help and opinion to confirm the specificity and reliability that these primers will give the wanted product.
Forward: GAGCAGTAGCTTAAGTGTTGGATG
Reverse: CTACCCACAGTGGGGAGTGACT

Thanking you in advance.
regards
Rafid

IP: 119.40.120.198

All times are ET (US)

next newest topic | next oldest topic

Administrative Options: Close Topic | Archive/Move | Delete Topic
Post New Topic  Post A Reply
Hop to:

Contact Us | HUM-MOLGEN

Copyright by HUM-MOLGEN 1995-2015

Powered by: Ultimate Bulletin Board, Version 5.44a
© Infopop Corporation (formerly Madrona Park, Inc.), 1998 - 2000.