home genetic news bioinformatics biotechnology literature journals ethics positions events sitemap


UBBFriend: Email This Page to Someone!
  HUM-MOLGEN
  Biotechnical requests and sources
  Difficulty in PCR amplification

Post New Topic  Post A Reply
profile | register | preferences | faq | search

next newest topic | next oldest topic
Author Topic:   Difficulty in PCR amplification
Administrator
Administrator
posted 09-24-2000 01:45 PM     Click Here to See the Profile for Administrator     Edit/Delete Message Reply w/Quote
Dear Dr

In a RAP-PCR experiment with Chinese hamster cell line under two different environmental conditions we obtained avery good fingerprinting pattern. however, during reamplification we faced a problem. The elution and reamplification has been done before in our lab. I am a little puzzled why it is not working. We guess something is wrong with the primer. Can it happen like that? DNA concentration is not a problem because the same primer is not working with other genomic DNAs as well. Primer seq is 5' GACCATTGCATAACGCTGAC 3' Several PCR conditions were tried with Boringer Manheim Taq and the buffer supplied.The same Taq worked with other samples. Can you suggest something of help?

Thanking you

Sincerely yours

Dr Keya Chaudhuri

IP: 160.45.191.21

daforerog
Member
posted 06-06-2004 12:01 AM     Click Here to See the Profile for daforerog   Click Here to Email daforerog     Edit/Delete Message Reply w/Quote
Try PCR adjuvants such as BSA or DMSO. It may be useful.

Good luck.

Diego.

IP: 168.176.160.13

All times are ET (US)

next newest topic | next oldest topic

Administrative Options: Close Topic | Archive/Move | Delete Topic
Post New Topic  Post A Reply
Hop to:

Contact Us | HUM-MOLGEN

Copyright by HUM-MOLGEN 1995-2015

Powered by: Ultimate Bulletin Board, Version 5.44a
© Infopop Corporation (formerly Madrona Park, Inc.), 1998 - 2000.