Administrator Administrator
|
posted 09-24-2000 01:45 PM
Dear DrIn a RAP-PCR experiment with Chinese hamster cell line under two different environmental conditions we obtained avery good fingerprinting pattern. however, during reamplification we faced a problem. The elution and reamplification has been done before in our lab. I am a little puzzled why it is not working. We guess something is wrong with the primer. Can it happen like that? DNA concentration is not a problem because the same primer is not working with other genomic DNAs as well. Primer seq is 5' GACCATTGCATAACGCTGAC 3' Several PCR conditions were tried with Boringer Manheim Taq and the buffer supplied.The same Taq worked with other samples. Can you suggest something of help? Thanking you Sincerely yours Dr Keya Chaudhuri
IP: 160.45.191.21 |